Website stats for Ruba3 - ruba3.com
#;-//WC//DTD XHTML . Strict//EN http://www.w.org/TR/xhtml/DTD/xhtml-strict.dtd> - .. .. ... - ...
ruba3.com was registered 2 decades 3 months ago. It has a alexa rank of #535,524 in the world. It is a domain having .com extension. It is estimated worth of $ 2,400.00 and have a daily income of around $ 10.00. Furthermore the website is generating income from Google Adsense. As no active threats were reported recently, ruba3.com is SAFE to browse.
Traffic Report
| Daily Unique Visitors: | 1,637 |
| Daily Pageviews: | 3,274 |
Estimated Valuation
| Income Per Day: | $ 10.00 |
| Estimated Worth: | $ 2,400.00 |
Search Engine Indexes
| Google Indexed Pages: | Not Applicable |
| Yahoo Indexed Pages: | Not Applicable |
| Bing Indexed Pages: | Not Applicable |
Search Engine Backlinks
| Google Backlinks: | Not Applicable |
| Bing Backlinks: | Not Applicable |
| Alexa BackLinks: | Not Applicable |
Safety Information
| Google Safe Browsing: | No Risk Issues |
| Siteadvisor Rating: | Not Applicable |
| WOT Trustworthiness: |
 Very Poor
|
| WOT Privacy: |
Very Poor
|
| WOT Child Safety: |
Very Poor
|
Website Ranks & Scores
| Alexa Rank: | 535,524 |
| PageSpeed Score: | 89 ON 100 |
| Domain Authority: |
49 ON 100 
|
| Bounce Rate: | Not Applicable |
| Time On Site: | Not Applicable |
Web Server Information
Hosted IP Address:
46.4.159.186
Hosted Country:
DE
Location Latitude:
49.4478Location Longitude:
11.0683Traffic Classification
| Total Traffic: | No Data |
| Direct Traffic: | No Data |
| Referral Traffic: | No Data |
| Search Traffic: | No Data |
| Social Traffic: | No Data |
| Mail Traffic: | No Data |
| Display Traffic: | No Data |
Search Engine Results For ruba3.com
Biotransformation of Various Alkanes Using the Escherichia coli ...
We have cloned and sequenced genes from Gordonia sp. TF6 encoding an AH system, alkB2 (alkane 1-monooxygenase), rubA3 (rubre- doxin), rubA4 (rubredoxin), ...
Red Climbing Malabar Spinach Alugbati Basella ruba - 3 Live Plant ...
3 live plant starter plugs (2 plugs) for planting *** Ships within the contentious 48 US states only*** The delicious Malabar spinach is a perenn.
بلاد زهران (@ruba3com) / Twitter
@ruba3com. ·. Aug 13, 2019 · #مهرجان_سوق_عكاظ_الطائف غير جو يوم الاثنين 11 ذو الحجة 1404هـ 1- الموقع بعيد نوعا مأ عن الطائف لكنه أفضل كموقع للمهرجان في ...
3 bedroom properties for sale in Ruba, Arabian Ranches 3
Search 3 bedrooms properties for sale in Ruba with maps & photos on www.propertyfinder.ae✓ Choose from our 3 BHK properties✓ Installment Payment Plans ...
الأستاذ الدكتور احمد بن علي الخماش الزهراني ( جامعة أم القرى )
http://www.ruba3.com/vb/showthread.php?t=30653. اخوكم المحترف (عضو منتديات رباع). السلام عليكم ورحمة الله وبركاته ،،،. كل عام والجميع بخير إن شاء الله تعالى.
Cocktails with a Curator: Ruba Katrib - Posts
Cocktails with a Curator: Ruba Katrib. Posted on February 16, 2018. ruba1. Adam Yokell, Paula Naughton, Kristen Lorello. ruba3. Adam Abdalla, Renaud Proch.
MUND RUBA 3 - YouTube
AboutPressCopyrightContact usCreatorsAdvertiseDevelopersTermsPrivacyPolicy & SafetyHow YouTube worksTest new features. © 2021 Google LLC ...
Barn Quilts - Midwest News
For information on a custom designed Barn Quilt contact Pam Zimple, 608-375-4537 or Ruth Bauer, [email protected]. Copyright, Midwest News, 2001- 2014 ...
www.ruba3.vg/
3 Bedroom Villas for Sale in Ruba - Bayut
Directly on Pool & Park | 1.5% Per Month | RESALE · Genuine Listing | Excellent Price | Modern Design · Contemporary I Spacious stylish 3 bedrooms Ruba · 3...
أكاديمـيـة العرضـة الجنوبيــة - ربـاع
منتدى رباع،قصائد،شعر،الباحة،جنوب،عرضه،دروس،إسلام،تعليم،قرية،صور،بلوتوث،مقاطع،كمبيوتر،منتدى،كتب،السعودية،بن مصلح،البيضاني،الغويد،أخبار،حوقان،جحلوط،جار الله ...
Gene Cloning and Characterization of Multiple Alkane Hydroxylase ...
Dec 17, 2020 ... In both strains, the alkB1 and alkB2 homologs were part of alk gene clusters, each encoding two rubredoxins (rubA1 and rubA2; rubA3 and ...
Rubredoxins Involved in Alkane Oxidation - CiteSeerX
pKKPalk, rubA3 (R. erythropolis NRRL B-16531). This study. pKKrubA4(Rer) ... RubA2, RubA3, and RubA4, rubA1FW [GGGGAATTCGCATGAACGCC],.
Como, ruba 3 boxer e li nasconde nelle mutande: furto a Intimissimi
Nov 5, 2021 ... Como, ruba 3 boxer e li nasconde nelle mutande: furto a Intimissimi. Due ladri complici sono entrati con cappello e mascherina: nonostante ...
Ruba 3 bottiglie di vino, un dipendente lo insegue e scoppia la lite
Jun 29, 2021 ... Ruba 3 bottiglie di vino, un dipendente lo insegue e scoppia la lite ... TRIESTE. Ieri sera la Polizia di Stato ha denunciato per furto aggravato ...
Super quantum airy structures - White Rose Research Online
Bła˙zej Ruba3, Piotr Sułkowski5,6. 1 Department of Mathematical and Statistical Sciences, University of Alberta, 632 CAB, Edmonton,. AB T6G 2G1, Canada.
Wishing You A Happy Birthday, Ruba! Best fireworks GIF animated ...
Jul 4, 2021 ... Download free happy birthday animated GIF for Ruba on her special day.
Sant' Anastasia, ruba 3 trattori: arrestato - L'Occhio di Napoli
Nov 4, 2021 ... Sant' Anastasia, ruba 3 trattori: arrestato il 50enne, giornata intensa per i Carabinieri della stazione locale.
Third Person Singular Number - Wikipedia
Third Person Singular Number is a 2009 Bangladeshi drama film directed by Mostofa Sarwar Farooki and written jointly by Mostofa Sarwar Farooki and Anisul ...
Functional analysis of long-chain n-alkane degradation by Dietzia spp.
CF8, 1, Fusion, AlkB domain: 49, −. Rub domain: 57. Rhodococcus erythropolis, 4, Translational coupling, AlkB2: 66, +. NRRL B-16531, RubA3: 57 ...
30 Crazy Fonts By Rodrigo - Thefancydeal
RUBA3 · RUBA4 · RUBA5. Negrita Pro by Rodrigo Typo. A type Display, contains, Regular, Oblique and Ornament! for children's titles, By Rodrigo Araya Salas.
Ruba 3 Asociados Sl - CIF y dirección | Empresite
Ruba 3 Asociados Sl en Santiago de Compostela LA CORUÑA. Conozca el teléfono de contacto, dirección, NIF y más información de Ruba 3 Asociados Sl.
Page Resources Breakdown
Homepage Links Analysis
Website Inpage Analysis
| H1 Headings: | Not Applicable | H2 Headings: | Not Applicable |
| H3 Headings: | Not Applicable | H4 Headings: | Not Applicable |
| H5 Headings: | Not Applicable | H6 Headings: | Not Applicable |
| Total IFRAMEs: | Not Applicable | Total Images: | 422 |
| Google Adsense: | pub-8814955360786094 | Google Analytics: | Not Applicable |
Two Phrase Analysis
| Words | Occurrences | Density | Possible Spam |
|---|---|---|---|
| | 17 | 6.513 % | No |
| World 26112021 | 17 | 6.513 % | No |
| Mandi World | 17 | 6.513 % | No |
| ~~ ~~ | 11 | 4.215 % | No |
| 8 Mandi | 4 | 1.533 % | No |
| 0317 AM | 3 | 1.149 % | No |
| 5 Mandi | 2 | 0.766 % | No |
| 0258 AM | 2 | 0.766 % | No |
| AM 10 | 2 | 0.766 % | No |
| 10 Mandi | 2 | 0.766 % | No |
| ~~ 18 | 2 | 0.766 % | No |
| 0313 AM | 2 | 0.766 % | No |
| 0417 PM | 2 | 0.766 % | No |
| 20052015 0220 | 1 | 0.383 % | No |
| 0940 PM | 1 | 0.383 % | No |
| 0220 AM | 1 | 0.383 % | No |
| 632 3941 | 1 | 0.383 % | No |
| PM 206 | 1 | 0.383 % | No |
| 765 ~~ | 1 | 0.383 % | No |
| AM 632 | 1 | 0.383 % | No |
Four Phrase Analysis
| Words | Occurrences | Density | Possible Spam |
|---|---|---|---|
| | 15 | 5.747 % | No |
| 8 Mandi World 26112021 | 4 | 1.533 % | No |
| 10 Mandi World 26112021 | 2 | 0.766 % | No |
| 5 Mandi World 26112021 | 2 | 0.766 % | No |
| 29122013 0245 AM 440 | 1 | 0.383 % | No |
| 0245 AM 440 465 | 1 | 0.383 % | No |
| 7 29122013 0245 AM | 1 | 0.383 % | No |
| 1894 7 29122013 0245 | 1 | 0.383 % | No |
| PM 524 1894 7 | 1 | 0.383 % | No |
| 524 1894 7 29122013 | 1 | 0.383 % | No |
| AM 440 465 3 | 1 | 0.383 % | No |
| 440 465 3 0940 | 1 | 0.383 % | No |
| 206 765 ~~ ~~ | 1 | 0.383 % | No |
| 765 ~~ ~~ 8 | 1 | 0.383 % | No |
| PM 206 765 ~~ | 1 | 0.383 % | No |
| 0940 PM 206 765 | 1 | 0.383 % | No |
| 465 3 0940 PM | 1 | 0.383 % | No |
| 3 0940 PM 206 | 1 | 0.383 % | No |
| 0451 PM 524 1894 | 1 | 0.383 % | No |
| 13 16032020 0451 PM | 1 | 0.383 % | No |
HTTP Header Analysis
Status-Code: 200
Status: 200 OK
Date: Thu, 16 Dec 2021 14:54:51 GMT
Server: Apache
Expires: 0
Cache-Control: private, post-check=0, pre-check=0, max-age=0
Pragma: no-cache
X-UA-Compatible: IE=7
Transfer-Encoding: chunked
Content-Type: text/html; charset=windows-1256
Domain Information
| Domain Registrar: |
GoDaddy.com, LLC
|
|---|---|
| Registration Date: | 2004-08-06 2 decades 3 months 1 week ago |
| Last Modified: | 2021-10-25 3 years 3 weeks 5 days ago |
Domain Nameserver Information
| Host | IP Address | Country | |
|---|---|---|---|
| ns1.ruba3.com | |
46.4.159.186 | Germany |
| ns2.ruba3.com | |
46.4.159.186 | Germany |
DNS Record Analysis
| Host | Type | TTL | Extra |
|---|---|---|---|
| ruba3.com | A | 14388 |
IP: 46.4.159.186 |
| ruba3.com | NS | 86400 |
Target: ns1.ruba3.com |
| ruba3.com | NS | 86400 |
Target: ns2.ruba3.com |
| ruba3.com | SOA | 86400 |
MNAME: ns1.ruba3.com RNAME: section-servers.topline.com.sa Serial: 2021101600 Refresh: 3600 Retry: 7200 Expire: 1209600 |
| ruba3.com | MX | 14400 |
Target: ruba3.com |
| ruba3.com | TXT | 14400 |
TXT: v=spf1 +a +mx +ip4:136.243.194.249 +ip4:46.4.159.186 +ip4:173.236.69.66 +ip4:208.115.247.187 +ip4:46.4.80.218 +ip4:46.4.58.112 +ip4:69.65.43.200 +ip4:74.86.130.98 ~all |
Full WHOIS Lookup
Registry Domain ID:
126512453_DOMAIN_COM-VRSN
Registrar WHOIS Server:
whois.godaddy.com
Registrar URL:
http://www.godaddy.com
Updated Date:
2021-10-25T11:54:01Z
Creation Date:
2004-08-05T17:50:56Z
Registry Expiry Date:
2022-08-05T17:50:56Z
Registrar: GoDaddy.com, LLC
Registrar
IANA ID: 146
Registrar Abuse Contact Email:
[email protected]
Registrar Abuse Contact Phone:
480-624-2505
Domain Status: clientDeleteProhibited
https://icann.org/epp#clientDeleteProhibited
Domain Status:
clientRenewProhibited
https://icann.org/epp#clientRenewProhibited
Domain Status:
clientTransferProhibited
https://icann.org/epp#clientTransferProhibited
Domain Status:
clientUpdateProhibited
https://icann.org/epp#clientUpdateProhibited
Name Server:
NS1.RUBA3.COM
Name Server: NS2.RUBA3.COM
DNSSEC:
unsigned
URL of the ICANN Whois Inaccuracy Complaint Form:
https://www.icann.org/wicf/
>>> Last update of whois database:
2021-12-16T07:24:54Z
Similarly Ranked Websites
Web design training in Surat: [2021 Updated course Module]
Fully practical advanced web design course in Surat. First web design institute in surat where classes are conducted by industry experts. ✓Low fees ✓Best ✓Job
535,535 
$ 2,400.00